Skeptic Friends Network

Username:
Password:
Save Password
Forgot your Password?
Home | Forums | Active Topics | Active Polls | Register | FAQ | Contact Us  
  Connect: Chat | SFN Messenger | Buddy List | Members
Personalize: Profile | My Page | Forum Bookmarks  
 All Forums
 Community Forums
 Humor
 Better Living Through Genetic Engineering
 New Topic  Topic Locked
 Printer Friendly Bookmark this Topic BookMark Topic
Author Previous Topic Topic Next Topic  

Dave W.
Info Junkie

USA
26037 Posts

Posted - 08/14/2004 :  11:54:16  Show Profile  Visit Dave W.'s Homepage Send Dave W. a Private Message
Okay, folks, another game thread, and here's the challenge:

Take a popular advertising slogan today, and "update" it for the hypothetically-coming age in which molecular-level genetic tinkering with plants and animals is the norm.

For example:

"...'Cause Oscar Mayer has a way with b-o-l-o-D-N-A."

Submit as many as you like.

- Dave W. (Private Msg, EMail)
Evidently, I rock!
Why not question something for a change?
Visit Dave's Psoriasis Info, too.

N C More
Skeptic Friend

53 Posts

Posted - 08/15/2004 :  08:25:35   [Permalink]  Show Profile Send N C More a Private Message
Ok, "It splices, it DNA dices! For all of your genetic recombinative needs...The 'Gene-Su Knife' is all you'll ever need!"

This is a fun idea

"An open mind is like an open window...without a good screen you'll get some really weird bugs!"
Go to Top of Page

filthy
SFN Die Hard

USA
14408 Posts

Posted - 08/15/2004 :  08:44:49   [Permalink]  Show Profile Send filthy a Private Message
Super Suds, Super Suds; splice your jeans in Super Suds!

From a '40s era radio, detergent commercial -- "wash your duds," it went.

Please forgive me, but I really don't know a hell of a lot about genetics beyond splicing fish roe with scrambled chicken eggs, and having a damned good breakfast. Pork brains will also produce excellent results.

But, I will try.


"What luck for rulers that men do not think." -- Adolf Hitler (1889 - 1945)

"If only we could impeach on the basis of criminal stupidity, 90% of the Rethuglicans and half of the Democrats would be thrown out of office." ~~ P.Z. Myres


"The default position of human nature is to punch the other guy in the face and take his stuff." ~~ Dude

Brother Boot Knife of Warm Humanitarianism,

and Crypto-Communist!

Go to Top of Page

Dave W.
Info Junkie

USA
26037 Posts

Posted - 08/15/2004 :  19:10:24   [Permalink]  Show Profile  Visit Dave W.'s Homepage Send Dave W. a Private Message
Hehehe. "Spice your jeans." This is off topic but:

Q: Why do we know that diarrhea is hereditary?
A: It runs in your jeans.

- Dave W. (Private Msg, EMail)
Evidently, I rock!
Why not question something for a change?
Visit Dave's Psoriasis Info, too.
Go to Top of Page

N C More
Skeptic Friend

53 Posts

Posted - 08/16/2004 :  12:03:55   [Permalink]  Show Profile Send N C More a Private Message
Q: How do we know that insanity is an example of "reverse heredity"?

A: Because you get it from your children!

"An open mind is like an open window...without a good screen you'll get some really weird bugs!"
Go to Top of Page

Valiant Dancer
Forum Goalie

USA
4826 Posts

Posted - 08/16/2004 :  12:21:00   [Permalink]  Show Profile  Visit Valiant Dancer's Homepage Send Valiant Dancer a Private Message
I'm probably gonna regret this but...


Splice your DNA with a Chevrolet.

and

Oh, I wish I was an Oscar Meyer mu-tant
That is what I'd truely like to be.
For if I was an Oscar Meyer mu-tant
Everyone would be so jealous of me.


Cthulhu/Asmodeus when you're tired of voting for the lesser of two evils

Brother Cutlass of Reasoned Discussion
Go to Top of Page

Ricky
SFN Die Hard

USA
4907 Posts

Posted - 08/16/2004 :  13:42:28   [Permalink]  Show Profile  Send Ricky an AOL message Send Ricky a Private Message
M&Ms, genetically modified shell dissolves in your mouth, not in your hand.

These are hard, thats all I could come up with.

Why continue? Because we must. Because we have the call. Because it is nobler to fight for rationality without winning than to give up in the face of continued defeats. Because whatever true progress humanity makes is through the rationality of the occasional individual and because any one individual we may win for the cause may do more for humanity than a hundred thousand who hug their superstitions to their breast.
- Isaac Asimov
Go to Top of Page

filthy
SFN Die Hard

USA
14408 Posts

Posted - 08/16/2004 :  13:47:59   [Permalink]  Show Profile Send filthy a Private Message
I crackle 'cause I'm crisp,
I taste better 'cause I'm fresh,
I'm a treat full of zip,
I'm a cloned potato chip!

This is making me wish I paid more attention to TV. Or maybe not.



"What luck for rulers that men do not think." -- Adolf Hitler (1889 - 1945)

"If only we could impeach on the basis of criminal stupidity, 90% of the Rethuglicans and half of the Democrats would be thrown out of office." ~~ P.Z. Myres


"The default position of human nature is to punch the other guy in the face and take his stuff." ~~ Dude

Brother Boot Knife of Warm Humanitarianism,

and Crypto-Communist!

Go to Top of Page

Dave W.
Info Junkie

USA
26037 Posts

Posted - 08/16/2004 :  14:57:02   [Permalink]  Show Profile  Visit Dave W.'s Homepage Send Dave W. a Private Message
ROLLING ROCK

From the precisely designed nematodes of
OLD LATROBE
we tender this premium beer
for your enjoyment, as a
tribute to your good taste.

It comes
from the UG1278XXZ strains
to you
"33"

- Dave W. (Private Msg, EMail)
Evidently, I rock!
Why not question something for a change?
Visit Dave's Psoriasis Info, too.
Go to Top of Page

filthy
SFN Die Hard

USA
14408 Posts

Posted - 08/16/2004 :  15:58:51   [Permalink]  Show Profile Send filthy a Private Message
...and they don't take American Express.

Visa, for whatever you want to be.


"What luck for rulers that men do not think." -- Adolf Hitler (1889 - 1945)

"If only we could impeach on the basis of criminal stupidity, 90% of the Rethuglicans and half of the Democrats would be thrown out of office." ~~ P.Z. Myres


"The default position of human nature is to punch the other guy in the face and take his stuff." ~~ Dude

Brother Boot Knife of Warm Humanitarianism,

and Crypto-Communist!

Edited by - filthy on 08/16/2004 17:18:56
Go to Top of Page

Dave W.
Info Junkie

USA
26037 Posts

Posted - 08/16/2004 :  21:08:47   [Permalink]  Show Profile  Visit Dave W.'s Homepage Send Dave W. a Private Message
Well, heck. A guy goes looking around for ad slogans to mess with, and finds that Coke's 2001 slogan is perfect for this thread just the way it was originally written:
Life tastes good.

- Dave W. (Private Msg, EMail)
Evidently, I rock!
Why not question something for a change?
Visit Dave's Psoriasis Info, too.
Go to Top of Page

Dave W.
Info Junkie

USA
26037 Posts

Posted - 08/16/2004 :  21:18:40   [Permalink]  Show Profile  Visit Dave W.'s Homepage Send Dave W. a Private Message
For those who might be wracking their brains, wanting to join in, starter material might be found at AdSlogans.com. Or at TV Acres.

And another entry from me: It takes a tough man to engineer a tender chicken.

- Dave W. (Private Msg, EMail)
Evidently, I rock!
Why not question something for a change?
Visit Dave's Psoriasis Info, too.
Go to Top of Page

H. Humbert
SFN Die Hard

USA
4574 Posts

Posted - 08/16/2004 :  22:46:28   [Permalink]  Show Profile Send H. Humbert a Private Message
Nice links, Dave! The very first two I read seemed appropriate. Completely unaltered:

"Free enterprise with every copy."
Brand: The Economist
(I envision a stream of identical-looking business men...)

"Go to work on an egg."
Brand: Egg Marketing Board

"A man is his own easiest dupe, for what he wishes to be true he generally believes to be true." --Demosthenes

"The first principle is that you must not fool yourself - and you are the easiest person to fool." --Richard P. Feynman

"Face facts with dignity." --found inside a fortune cookie
Edited by - H. Humbert on 08/16/2004 22:51:56
Go to Top of Page

Ricky
SFN Die Hard

USA
4907 Posts

Posted - 08/16/2004 :  23:22:28   [Permalink]  Show Profile  Send Ricky an AOL message Send Ricky a Private Message
"Just splice it." - Nike

Why continue? Because we must. Because we have the call. Because it is nobler to fight for rationality without winning than to give up in the face of continued defeats. Because whatever true progress humanity makes is through the rationality of the occasional individual and because any one individual we may win for the cause may do more for humanity than a hundred thousand who hug their superstitions to their breast.
- Isaac Asimov
Go to Top of Page

Dave W.
Info Junkie

USA
26037 Posts

Posted - 08/17/2004 :  06:52:17   [Permalink]  Show Profile  Visit Dave W.'s Homepage Send Dave W. a Private Message
"With a sequence like
ATTGGCATGCTGATCGATAAAGCTCTCGCC
CCGCTCGCGATAGCTCGATCGCTAGCTCGC
TAGATAAAAATCGCTCTAGCTCGATCCGCG
GCGCGTTATAGCTCGATGAGTGTGTGTGCG
CGCCCTAGAGATAAGAGATAGACACGCGCA
GAATAGACAGCAGATAGAGCAGACAGATGG
TTGTTTTTGCGCGCATAGCAGACGACAGCA
                           GAC
it has to be good." - Smuckers

- Dave W. (Private Msg, EMail)
Evidently, I rock!
Why not question something for a change?
Visit Dave's Psoriasis Info, too.
Go to Top of Page
  Previous Topic Topic Next Topic  
 New Topic  Topic Locked
 Printer Friendly Bookmark this Topic BookMark Topic
Jump To:

The mission of the Skeptic Friends Network is to promote skepticism, critical thinking, science and logic as the best methods for evaluating all claims of fact, and we invite active participation by our members to create a skeptical community with a wide variety of viewpoints and expertise.


Home | Skeptic Forums | Skeptic Summary | The Kil Report | Creation/Evolution | Rationally Speaking | Skeptillaneous | About Skepticism | Fan Mail | Claims List | Calendar & Events | Skeptic Links | Book Reviews | Gift Shop | SFN on Facebook | Staff | Contact Us

Skeptic Friends Network
© 2008 Skeptic Friends Network Go To Top Of Page
This page was generated in 0.14 seconds.
Powered by @tomic Studio
Snitz Forums 2000